Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-C20824

Search information 
Request: 20824Match: SGN-C20824
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C20824Clone name: cLED-30-M22
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176159 is on microarray TOM1: SGN-S1-1-4.4.11.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176159 [TUS-23-D13] Trace: SGN-T181346 EST: SGN-E368419 Direction: 3' Facility: INRA
Clone: SGN-C176159 [TUS-23-D13] Trace: SGN-T181347 EST: SGN-E368420 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242528Length: 504 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242528 [] (trimmed) TGCAATCAAAAGGAGATACTCAAGGTGAAGAACAGCTTAAAGATTTACTTAGGGTGCGAGGTCTCTGCTCGAAAGAATTTGAGGGGGGTTTAGAT
AAGTATATTGAAATTGGAAATCGCAAGTCCGAGGCACTTAATGAAACAGACCTTGAGGAGACTTGTTGACACTGGATGCCGGATTATACGATTCT
CTAAATTTTTATCATGATCACTAATCAAAACTTTCTACTGCCTTTTATTAGTTGGGTTTTTCAATTGCTGCTTCTAAAAGAATGATCTCTGCCTC
TGTTCTATAGTTGCAGACTTGGCAGGTAGAAGTAGCGTTCAGTGATCACTTCTCGGTTCTATTTTTCGAAAAATAGGCAGTGTCATGATTCATGG
AATTCAAATTTTTACAGGTTAAACTTCTTTCACTTATAGAATTTGAAACTCCGGGAAAGTGGTTCTTTTTACAAGTTTCCTTCGTTACTTTTACA
AGCTGTAACTTTTTTTTTTTTTTTGGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242528] SGN-U575720 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56458 [Download] [View] Facility Assigned ID: TOVEN83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0158 Quality Trim Threshold: 12.5