EST details — SGN-C21097

Search information 
Request: 21097Match: SGN-C21097
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C21097Clone name: cLED-31-K17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181559 is on microarray TOM1: SGN-S1-1-4.1.12.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181559 [TUS-37-E13] Trace: SGN-T194293 EST: SGN-E392967 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E242727Length: 569 bp (711 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E242727 [] (trimmed) CAATTATCTCGATATTCCTTCCATCTCAGTTTATATTTTAGTTAAATAATTTCTTGTACTACATATTTTTAATTACTAACAATATTGAATTGTTA
GCAAGTATTTAAAATTTTCAAATATATTTTTATTTTAAAGAATTAAGTATTTTAACCTTTGTACTACGTCATCGTATAAATTCAGACGCAAGAAA
TACTAGTAATACATAAGGTGTAGGAAGAGAAAGATTTCCTCTATCTCCTTCATTTTTTTACTAAAAAAAAAAGAAGTTGCTAGTGAGTTAGGCCT
ATATAGTGTGTTACTTTTTGGTTCTTCACAATATTTTTCTCTATTTCCTCTATTGTGTTTTATGTAAAAATGGCTGGTATGCTACCTGGTGTTGA
ATGTGCTAGAAGAAGGAGATTTCATCAAAGTAATGGATGTATAGATTCATCAAACACCTCTAGTTTTTCATCCACAAGAAGGTCTTCTTTTTGTC
TATACACTAGTAATCATGAACACCACCTCAATTCAAGTTCATCCAAGCAAAGGGGTGTAATAAGTCAAGCATATCAAGATGAGAAACTAGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E242727] SGN-U577663 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56646 [Download] [View] Facility Assigned ID: TOVEQ69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5