Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C21397

Search information 
Request: 21397Match: SGN-C21397
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C21397Clone name: cLED-33-I23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181647 is on microarray TOM1: SGN-S1-1-4.1.12.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181647 [TUS-37-I5] Trace: SGN-T194316 EST: SGN-E392990 Direction: 5' Facility: INRA
Clone: SGN-C181647 [TUS-37-I5] Trace: SGN-T199303 EST: SGN-E397977 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239728Length: 499 bp (703 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239728 [] (trimmed) CAGAAACAGACTTTCTGGTCCATTGCCTTCATCCTTGAACAACTGCACACGATTGTGGAAAATAGACATGAATGAGAATGAGTTAGATGGAAATT
TACCACCTTGGTTTGGTACACTTTCAAAGCTGATAGTCCTGAGTCTTCGGTCTAATAAATTCGATGGTGAACTAGCTCCAGAACTTTGCAAGCTC
AATGATCTTCAAATCTTGGATCTTGCCAACAACAATTTGTTTGGAGCTATACCTCGGTGTGTTAACAATTTCACAGCAATGGTGAATGGAAGGAA
GGAAATTAGAGACGGAGACGACGAGATGGATTATTCTTATTATGTTGGAGTTTTCAGGGAGAGTGCAAGAGTAGCATCTAAGGGTCACATGTATC
AGTATGATACCATTTTGTGATTGTTTACAAGCATGGATCTTTCTAACAATAGCCTTTCTGGAAACATTCCTATGAGTCTTACAAGTCTTGTTGGA
TTGAGATCATTAAATTTCTCCCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239728] SGN-U567439 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57001 [Download] [View] Facility Assigned ID: TOVEY60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5