EST details — SGN-C21628

Search information 
Request: 21628Match: SGN-C21628
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C21628Clone name: cLED-34-K19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176232 is on microarray TOM1: SGN-S1-1-3.3.11.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176232 [TUS-23-G14] Trace: SGN-T181139 EST: SGN-E369101 Direction: 3' Facility: INRA
Clone: SGN-C176232 [TUS-23-G14] Trace: SGN-T181140 EST: SGN-E369102 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243560Length: 568 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E243560 [] (trimmed) AAGGAGCCTAAGTTCTTGAAGAATGGTGATGCTGGTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCCGAATACCCACC
ATTGGGTCGTTTTGCTGTGAGGGACATGAGGCAAACTGTTGCTGTGGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCA
CCAAGGCTGCCCAGAAGAAGGGAAAGTAGAGTGCATTTGATGAGCACGGATGAAATAGTTTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTT
TGGACAGCATTTTGCCAGTTTTGGATATGGCTACAGAAGGTATTGTCATGGTTCTCTAGCCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTA
TGTCGGGACCAAATTACTTGATGGGCAATGACATATAGCTCTGTTGGTTGTTCCTTTACCTGGGTTAAATCACTTTACACACAGTCTTGGTCACT
GCTCAACTTATTTAAGTTTATGAAATTTTGAGTATATTTCCTTCTAAGATCTTGTTCCTGTTTCATGGTATTAGATTTTTCTTTTGGTTCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243560] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57334 [Download] [View] Facility Assigned ID: TOVFC70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0035 Quality Trim Threshold: 12.5