EST details — SGN-C22089

Search information 
Request: 22089Match: SGN-C22089
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C22089Clone name: cLED-36-H15
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184450 is on microarray TOM1: SGN-S1-1-1.1.16.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184450 [TUS-44-M24] Trace: SGN-T198222 EST: SGN-E396896 Direction: 3' Facility: INRA
Clone: SGN-C184450 [TUS-44-M24] Trace: SGN-T198223 EST: SGN-E396897 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241631Length: 482 bp (753 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241631 [] (trimmed) CAGGTCTGATCCTGATGATCGTTGCGGGTGGGGTATTTCACCCAGAGGTGCTGGATATACATTTGGCCAAGATATATCTGAACAGTTTAATCACA
CCAACGGCTTAAAACTAATTGCGAGAGCACACCAGCTGGTTATGGAGGGATTCAATTGGGCCCATGATCAAAAAGTGGTTACCATATTTAGTGCC
CCTAATTATTGCTACCGCTGTGGGAATATGGCGTCCATCTTGGAAGTTGACGATTGCAATGGCCATACATTCATTCAGTTTGAACCAGCTCCTAN
GCGAGGAGAGCCAGATGTAACGCGAAGAACACCAGATTACTTCTTATGATCAAAGCTGCACAAACTTGGTGATTTTATCGCATCAGTTCTTGATA
AACTGGTCTATATGCTATGACCATCTGTGAAATCCTATAGTTATTACAGATTGCGACATTGCAAGTTGCACAAAGCATGCAAATCGTGCACGTGA
TTCATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241631] SGN-U567353 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T57801 [Download] [View] Facility Assigned ID: TOVFM44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5