Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C22824

Search information 
Request: 22824Match: SGN-C22824
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C22824Clone name: cLED-3-J17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184026 is on microarray TOM1: SGN-S1-1-1.4.19.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184026 [TUS-43-L8] Trace: SGN-T1808 EST: SGN-E378628 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184026 [TUS-43-L8] Trace: SGN-T197972 EST: SGN-E396646 Direction: 5' Facility: INRA
Clone: SGN-C184026 [TUS-43-L8] Trace: SGN-T199950 EST: SGN-E398624 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E228375Length: 643 bp (866 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E228375 [] (trimmed) GAACTTTGAAAAACGGAAATGTAGTAGCTGTTAAAAAACTAGCAATTATGTCAAGCAGAGCGAAAGCAGATTTTGAGACTGAAGTTCGTCTTATC
AGTAATGTCCATCATCGCAATCTCATCCGTCTCTTGGGATGTTCAAACAAAGCATCAGACCTACTACTTGTTTACGAATACATGGCAAATGGCAG
CCTCGAAAGATACTTATATGGAGACAGACGAGGGATGCTCAACTGGAAGCAAAGATTCAATATAATCTTTGGCACAGCTCGTGGCCTTGCATACT
TGCACGAGCAATTCCACGTCTGCATCATCCATCGAGATATAAAATCCAGCAACATTCTACTAGACGACGAATTCCAGCCAAAGATAGCTGATTTT
GGGCTTGTAAGACTTTTACCTGAGGATCAAAGTCATGTTAGCACTAAGTTTGCTGGTACAATGGGATATACTGCACCAGAATATGCAATTCATGG
ACATCTAACAGAGAAAGTTGACGTCTATAGCTTTGGTGTTGTCGTTCTTGAAATAATCAGTGGAAGGAGGAGCAACGATATGCAAATCGAGCCTG
TCACTGAATATCTACTCGAACAGGCGTGGAAGCTTCATGAAACTGGCACGCCTGTAAAACTAGTGGACGAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E228375] SGN-U586568 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49023 [Download] [View] Facility Assigned ID: TOVAK57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5