Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C22980

Search information 
Request: 22980Match: SGN-C22980
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C22980Clone name: cLED-4-C3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174386 is on microarray TOM1: SGN-S1-1-1.2.16.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174386 [TUS-18-J16] Trace: SGN-T197352 EST: SGN-E396026 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231608Length: 549 bp (825 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231608 [] (trimmed) CAGGTTCATTTCGACAAGATCTTAGTGAATACATTCATGGCATGCTCAATTTCCATGTCCAAACTAAGTCGCCGTTCCTTATAAATTTCTATCCA
TTCTTTGCATACAAAGACAAACCCAACGAAGTTCCGCTTGATTATGTACTTTTCCAGCCTAACCAAGGTACGACTGACCCGATCACGAATTTGAA
GTATGACAACATGTTGTATGCACAAATTGATGCAGTTTATTCAGCAATTAAGGCAATGGGCCACACAGACATTCCAGTTAAGGTTTCCGAAACTG
GCTGGCCATCAAAGGGAGACCCGAATGAGTTTGGAGCAACACCTGAAAATGCTGCACTATATAACGGTAATTTGTTTCAGCGTATGCAGCAAAAT
CAAGGGACTCCAGCAAAGCCATCAGAGCCCATCGATGTTTACGTGTTTGCACTTTTTAACGAAAATTTAAAGCCTGGTCCAGCATCAGAGAGGAA
TTATGGTCTCTACTACCCTGATGGAACTCCAGTTTATAACATCGGGTTACGAGGGTTTCTTCCACGTATGGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231608] SGN-U585972 Tomato 200607 Build 2 57 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49377 [Download] [View] Facility Assigned ID: TOVAM14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5