EST details — SGN-C23027

Search information 
Request: 23027Match: SGN-C23027
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23027Clone name: cLED-4-E4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174424 is on microarray TOM1: SGN-S1-1-3.4.16.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174424 [TUS-18-L6] Trace: SGN-T197357 EST: SGN-E396031 Direction: 3' Facility: INRA
Clone: SGN-C174424 [TUS-18-L6] Trace: SGN-T197358 EST: SGN-E396032 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231467Length: 517 bp (1153 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231467 [] (trimmed) GAAGTTTGGTAGCCACAACTGGCCATTGATAGTTGGTTTAACTGCGACTGCTGATGAAAATGTTACTGGAAGATGCCTGCAGATTGGAATGAATG
GACTTATTCGTAAACCAGTGCTATTGCCAGGTATCGCTGATGAGCTTCAAAGGGTTCTGCTACGGGGAAGTAGAATGATGTAATTGATGTTGACG
GTGCCTTATAGGAGTGGAGTTTATAAGGCAGGGCTTCATCAACCACGTAATGCTAGATGTTCAAACGAAATTGCTTGGACCACTTCCCACCCCTG
AAGATTCCAGCATACAGATGTAACGTACATACAATCTTTGAAATCAAAATGGTACAGAAAATATATCGTCTTTTCTACTCTCATAAAAGCCCTCA
GCTCTAAAGGATTTGAGCCAGGTTTGCCGATTCTACATGTTATTGAGCTTAGCAACTCAGAATATTTAACTAATCTGTTGTTAGAACTGAAAAGT
ATATACTGTTGAGAAATGACTCCAGAATAGCTCCATTTCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231467] SGN-U581695 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49236 [Download] [View] Facility Assigned ID: TOVAN26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5