EST details — SGN-C23083

Search information 
Request: 23083Match: SGN-C23083
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23083Clone name: cLED-4-H12
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174467 is on microarray TOM1: SGN-S1-1-8.2.16.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231576Length: 569 bp (745 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231576 [] (trimmed) CAAATTTTGATCTTTCTCTCACGCGCTGTCAACATTTCTCCTCGGCGATTTCCGGCGACGATCCGATTTTCCGGCGATATCCAACCGTAGAGAAC
AGAGACATCCTGCTTCCCTTCGTCTTGGATCAGTCGACTTCTTCGTTTCGCAAAATCATGAATCCCGAATATGATTATTTGTTCAAACTTTTGTT
AATAGGAGATTCAGGTGTTGGAAAGTCATGTCTTCTCCTGAGATTTGCCGATGATTCTTATTTGGACAGCTACATCAGCACAATTGGTGTTGACT
TTAAAATACGTACTGTGGAGCAAGATGGGAAGACTATTAAACTTCAAATTTGGGACACTGCTGGACAAGAACGTTTCAGGACAATCACAAGTAGT
TACTACCGTGGGGCACATGGCATTATAATAGTTTATGATATAACTGATCAAGAAAGTTTCAACAATGTTAAGCAATGGTTGAGTGAAATTGATCG
CTATGCAAGCGAAAACGTGAACAAGCTTTTGGTTGGAAATAAGTCTGACTTGAATGATAACCGAGCTGTGTCTTATGATACAGCAAAGGCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231576] SGN-U577954 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49345 [Download] [View] Facility Assigned ID: TOVAP42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5