EST details — SGN-C23206

Search information 
Request: 23206Match: SGN-C23206
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23206Clone name: cLED-4-M2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174549 is on microarray TOM1: SGN-S1-1-6.1.15.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174549 [TUS-19-A11] Trace: SGN-T197402 EST: SGN-E396076 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231494Length: 552 bp (1147 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231494 [] (trimmed) ATGATGGCCCAGATTGAGGTTCTGAGGAAGAAAGGACATTCTTACTCCGAGATTATCAATGAAAGCGTCATCGAGTCTGTAGATTCTTTGAATCC
GTTTATGCACGCTCGTGGAGTATCATTCATGGTTGACAATTGCTCAACAACAGCACGTCTAGGTTCCAGGAAGTGGGCCCCTCGATTTGATTACA
ATCTCACCCAACAAGCACTTGTAGCCGTGGATAACAACACGCCTATCAACCGTGATCTCATCAGCAACTTCCTTGCAGATCCCGTGCATGGAGCT
ATTAAAGTGTGTGCTGAACTAAGACCCACAGTTGATATTTCTGTAACAGCAGATGCTGATTTTGTCCGCCCTGAGCTCAGGCAATCTGTCAATTA
AGGGCTTTACGGGTCACTTTGTGAGCGAGCAAGTGAGAATTAGTGATGTTGAGATTTCATATTGTTGATGTGTGTTGGTGAAGGCAAGAATACTT
AAATCTGTTAGCTTATAAGAATCTTAGCCGCTTTTCGTTGTTTAGTTACGTTGGTACTAGCACTTTTTTATGTAACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231494] SGN-U572728 Tomato 200607 Build 2 104 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49263 [Download] [View] Facility Assigned ID: TOVAN73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0119 Quality Trim Threshold: 12.5