EST details — SGN-C23214

Search information 
Request: 23214Match: SGN-C23214
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23214Clone name: cLED-4-M5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174555 is on microarray TOM1: SGN-S1-1-8.1.15.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174555 [TUS-19-A17] Trace: SGN-T197404 EST: SGN-E396078 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231643Length: 542 bp (810 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231643 [] (trimmed) CAGGGAAGACCTTAAGAATGAGTTTGAGCGCGCCAATGGGAGTCAAATTGAAACTGCTGCTAGACCATATGCTTTTATTAAATTTGATACATTCA
TACAGAAGACGAAGAAACTGTACCAGGATACTAGAACTCAACGCAACATTTCTAAGTTGAATGATGAGCTTTACGAAGTTCATCAAATAATGACT
CGAAATGTTCAAGAAGTTCTTGGAGTTGGTGAAAAGTTGGACCAGGTCAGTCAAATGTCCAGCCGTTTGACATCTGAATCCCGGATATATGCTGA
TAAAGCAAAAGACTTAAATCGTCAGGCTTTGATTCGAAAATGGGCTCCTGTTGCTATTGTGCTTGGAGTTGTCATTCTCTTCTTCTGGCTCAGAA
CAAAGATCTGGTGATGCTTCCATACAGATGCAGCTCAGTGACGACAATACTGTCAAATGTTTTATTCATATTTGTCACCATCAGACTCTGCACAA
CCCAGAGAACCACCTCACATTACAGTTATCCAGCATGTGTTGTGCCATATCAGTTTTATAGTGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231643] SGN-U567536 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49412 [Download] [View] Facility Assigned ID: TOVAM75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5