EST details — SGN-C23231

Search information 
Request: 23231Match: SGN-C23231
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23231Clone name: cLED-4-N20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174568 is on microarray TOM1: SGN-S1-1-3.2.15.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174568 [TUS-19-B6] Trace: SGN-T189533 EST: SGN-E377179 Direction: 3' Facility: INRA
Clone: SGN-C174568 [TUS-19-B6] Trace: SGN-T189534 EST: SGN-E377180 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231774Length: 475 bp (767 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231774 [] (trimmed) TTTACAACTAATACAAAATGGAGGCAAAGTTTGCTCACATCATTCTGTTCTTTCTTCTTGCATTTTCTTTTGAAACTCTCATGGCACGAAAAGAA
AGTGATGGACCAGAAGTCATAAAACTTCTAAAAGAATTTGAATCCGCATCTTGGTGCAAAGGAAAACAATTTTGGCCAGAACTTATTGGTGTACC
AGCACAATATGCTAAGGGAATAATTGAGAAGGAAAATCCATCCATAGCTAATATTCCAATATTATTGAATGGTTCTCCAGTCACAAAGGATTTTC
GATGTGATCGAGTTCGTCTTTTTGTTAACATTTTGGGTGATGTTGTACAAATTCCCAGAGTGACTTAAATTATTGGATTATTGAAGTAATTAAGC
AGCCACATATTAAAAATAATTAGGGTTCATGTTGATTATAATGTCTCCATGTACTCTTACTATATATATAATGGAATAAATAAAACGTGGCTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231774] SGN-U578279 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49543 [Download] [View] Facility Assigned ID: TOVAP82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0067 Quality Trim Threshold: 12.5