EST details — SGN-C23306

Search information 
Request: 23306Match: SGN-C23306
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23306Clone name: cLED-5-A4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174618 is on microarray TOM1: SGN-S1-1-1.4.15.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174618 [TUS-19-D8] Trace: SGN-T189543 EST: SGN-E377189 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231160Length: 340 bp (426 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231160 [] (trimmed) CAGAGTTGCTCTACAGAGAGATGATGTTGAACTAGTTGCAGTGAATGATCCATTTATTTCCACTGATTACATGACATATATGTTTAAGTATGATT
CAGTACATGGACAATGGAAGCATCATGAGCTAAAGGTCAAGGATGAGAAGACACTTCTCTTTGGAGAGAAGGCTGTTACAGTTTTTGGAATCAGG
AACCCTGAAGATATCCCATGGGGTGAAGCTGGTGCTGACTTCGTTGTTGAATCAACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGCTCACTT
GAAGGGTGGTGCCAAGAAGGTTGTGATCTCTGCTCCTAGCAAAGAATGCTCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231160] SGN-U580213 Tomato 200607 Build 2 353 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49776 [Download] [View] Facility Assigned ID: TOVAR02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5