EST details — SGN-C23495

Search information 
Request: 23495Match: SGN-C23495
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23495Clone name: cLED-5-I4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174735 is on microarray TOM1: SGN-S1-1-4.1.15.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231187Length: 349 bp (428 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231187 [] (trimmed) CTCAGTCTCAAGAGCTTTTTAGAACGCTTCAGCGCTATTACAGTAATGCCTACATGGATGCTGAGAAACAGGATGCCATTAATGTGTTTTTGGGA
CATTTCCGCCCTCAAGAAGGTAAGCCAGCTCTTTGGGAATTGGATTCAGACCAGCACTATAGTGTTGGGGGGCACGCATCAAGTTTAGCAATGGA
GAGTTCTAGGTCATTTATTAAAAGGTCGCTGTCAGAAGGAAATTTGATCTGTGGAAGCAACTCTCCTGTCAAAGAAACTGACACAGAGCAGACCG
ATGACTCTGACCAACCTTTGCCTGAGAGTGCAAAAGGTGGTAGTAAGGGGGTCTTTCCGAGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231187] SGN-U576863 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T49803 [Download] [View] Facility Assigned ID: TOVAR50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5