Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C23720

Search information 
Request: 23720Match: SGN-C23720
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23720Clone name: cLED-6-C3
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174896 is on microarray TOM1: SGN-S1-1-3.3.15.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174896 [TUS-19-O22] Trace: SGN-T189347 EST: SGN-E376733 Direction: 3' Facility: INRA
Clone: SGN-C174896 [TUS-19-O22] Trace: SGN-T189348 EST: SGN-E376734 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233218Length: 536 bp (802 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233218 [] (trimmed) AAATTGAATCTTTTCAGTGAACTTTTACTATTTGGTCAATCAAGAAGTGAAATTACAGAGCAAAAGCAGATATAGTTTTGAAGATGGCAGGTTAC
AGAGGTGATGATGAGTATGATTACCTTTTCAAGCTTGTGTTGATAGGTGATTCAGGTGTGGGTAAATCTAATCTGCTTTCCAGGTTCACCAAAAA
TGAATTCAATTTGGAGTCTAAATCAACTATTGGGGTTGAATTTGCAACCAAAAGTCTTAATATTGATGGTAAAGTTATTAAAGCTCAGATTTGGG
ATACTGCTGGTCAAGAAAGGTATCGTGCCATTACGAGTGCTTATTATCGGGGAGCTGTCGGTGCTTTGCTCGTATATGATGTTACTCGACATGTT
ACCTTTGAAAACGTCAACAGGTGGTTGAAGGAATTGAGAGACCATACTGACCCTAACATTGTAGTCATGCTCCTAGGCAACAAATCAGATCTCCG
ACATCTCGTGGCTGTTTCAACTGAAGAGGCTAAATCTTTGGCAGAGAGGGAAGCCCTATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233218] SGN-U564990 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50204 [Download] [View] Facility Assigned ID: TOVAU14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5