EST details — SGN-C23745

Search information 
Request: 23745Match: SGN-C23745
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23745Clone name: cLED-6-D6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174917 is on microarray TOM1: SGN-S1-1-6.4.15.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174917 [TUS-19-P19] Trace: SGN-T189472 EST: SGN-E376858 Direction: 3' Facility: INRA
Clone: SGN-C174917 [TUS-19-P19] Trace: SGN-T189473 EST: SGN-E376859 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233283Length: 483 bp (914 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233283 [] (trimmed) CTGGTTTTTGGTGATCTAGTCTTTATACCGTTCACCTTCAGTATTCAGGGTTGGTGGCTTTTGAGTAACAAAGTGGAGCTAACAACAGCAGCAAT
AATTGCCAATTGCCTCGTCTTTCTTATTGGGTACTCGGTGTTCAGAGGAGCCAATAAGCAGAAGCATGTATTTAAAAAGGATCCCAAGGCACCCA
TATGGGGTAGTCCTCCAAAAGTTATTGGGGGAAAGTTGCTTGCTTCTGGCTATTGGGGCATTGCACGGCACTGTAATTACCTCGGGGATTTGTTG
CTGGCATCGTCTTTTAGTTTACCTTGTGGTATAAGCTCTGTGGTTCCATACTTTTACCCCATATATCTTCTCATTCTACTCATATGGAGGGAGAG
AAGGGACGAAGCTAGATGTGCAGAGAAGTACAAAGATGTGTGGGCTGAATACCGTAAACTTGTTCCTTACAGGATCTTACCTTACGTTTACTAGC
TCAATCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233283] SGN-U582281 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50269 [Download] [View] Facility Assigned ID: TOVAX15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5