EST details — SGN-C23748

Search information 
Request: 23748Match: SGN-C23748
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23748Clone name: cLED-6-D9
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184145 is on microarray TOM1: SGN-S1-1-2.1.16.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233174Length: 575 bp (1324 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233174 [] (trimmed) CAAATTAAAGCCATTCTTCACTCAAAATTAAGAATACCAAACTCTCTTATCTTTTAAATTCATCAAAAAAAATGGGAAAACTTTTGGCTGTGACT
TTTTTGTTCATGTGTTGTGTTGTTCCAAGTTTGGCCAAAGTTTATACTGTTGGAGACTCATCTGGATGGGGACTTGGTGTGGATTATACCACTTG
GGCTAGTGGAATCACTCTTAATGTTGGTGATTCACTTGGTAAGTTTTCTCCCCCATATATACACATTTTTTTTACTTAAACAAATCTAGAAATTA
TCATTACATATGAAAATATCAGGTAATCATAACAAACTCCCTTTATTTTAATTTATATGACATCATATATATATTTAAAAAATGAAAAAAAAAAA
TTTAACTTATCATTTAAAACAAACCTTAGACAATAGACGTACTATAGAAATTCGCCATTTTCTGAACGTCGTTGAGATAATGCATAAAAAGCTAT
AAATTCTTCGCGGAGATAAAATGAAAAATTTGAAGTTAATTAAATTGCTTTTAAATATAGAAAAATAGTATTCTTTCTGCTACATAAGTTTATAT
GTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233174] SGN-U583177 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50160 [Download] [View] Facility Assigned ID: TOVAW17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.916 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5