Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C23769

Search information 
Request: 23769Match: SGN-C23769
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23769Clone name: cLED-6-E6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174938 is on microarray TOM1: SGN-S1-1-1.1.13.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233149Length: 189 bp (1310 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233149 [] (trimmed) CAGGTTGGTTGGTCCAACCTATTCTTGAAATAAACAACTCGCACACACTCCCTTTCCAAAAAAAATCAATACACCAAGCACTACACTTAGATTTA
TTGGATTTGTTGCTAAAATATCGGTATTAAACCCGAAACTCCCGGCAGATGGCCAGTGGCCCAAAGAAACGAAAGAATCGGTTACGTTTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233149] SGN-U565528 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50135 [Download] [View] Facility Assigned ID: TOVAV27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5