Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C23820

Search information 
Request: 23820Match: SGN-C23820
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23820Clone name: cLED-6-H1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C174983 is on microarray TOM1: SGN-S1-1-4.3.13.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174983 [TUS-20-C13] Trace: SGN-T189745 EST: SGN-E376990 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233179Length: 536 bp (1364 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233179 [] (trimmed) GAAGAACTTTCACTGGATTCAGTGAAGCAGTATAAAGTGCAGTGTCCGGACGAACTTTCAAAAATCATGGTGATTAAAGACAGAATACTAGAACT
AGGACAGAAGGTGGGGCAAACAATTATATTTGTTCGTACCAGAAACAGTGCAAGTATGTTGCATAAGTCATTGGTTGACTATGGCTATGAAGTGA
CAACAATTCAAGGTGCTCTTAGGCAAGAAGACAGAGACAAAATAATCAAGGAGTTCAAAGATGGATTGACACAAATTCTTATATCAACTGATCTT
CTTGCTCGTGGATTTGACCAATCACAGGTTAATTTGGTGGTTAATTATGACCTCCCTGTGAGACACGAGAGTCCAACAGAGCCAGATCATGAGGT
ATACCTGCATCGGATTGGTAGAGCAGGACGTTTTGGACGCAAGGGTGCGATATTCAACTTGCTGTGCAGTGACAGAGACAACATGCTAATGTCAA
AGATTGAGAACCATTTCAACCATCAAGTGGCTGAGATTCCCTTATGGAGTAATGAAGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233179] SGN-U586037 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50165 [Download] [View] Facility Assigned ID: TOVAW37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5