EST details — SGN-C23845

Search information 
Request: 23845Match: SGN-C23845
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23845Clone name: cLED-6-I10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175006 is on microarray TOM1: SGN-S1-1-5.4.13.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175006 [TUS-20-D12] Trace: SGN-T190179 EST: SGN-E377957 Direction: 3' Facility: INRA
Clone: SGN-C175006 [TUS-20-D12] Trace: SGN-T190180 EST: SGN-E377958 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233250Length: 556 bp (1333 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233250 [] (trimmed) GAAGATCCGAAAAACTTCAGGAAAACCATTGGGAGAATAATGAGCGCCCAACACTCCATACCCGATTATGTACGAGTCACACCAGATTGCAGGAA
CCTCCTTTCGCGAATCTTTGTTGCAAATCCCTCTAAGAGGATAACTATTCCTGAGATAAAGAAACATCCTTGGTTCTTAAAGAATCTACCAAAAG
AGCTGATGGATGTTGAGCACGCGAGATTCGAAGAAGCTTCAGAGCAACTACAACAAAGTGTTGAAGAAATCATGAAGATGATACAAGAAGCTAAA
GTACCTGGAGTAGTGTCAAAATCTGAAGGGAAAGATCCTGCAGGGACAGCAGAACAAGATGATTTAGAGGAAGACCTCGAATCGGAAATCGACAG
CAGCAATGACTTTGCTGTTTATGTCTGAGGATGAAATTTTATGATCAATTTGAACTTATAAGAGAAAAAAATGTTTAATATGTTAACTCTTTGTA
TTGTTAAAATTATGGCTTTGTATAGATGAGTTATGCACAGAGCTGCTATTTACTGAGTTCTAAAGTGTGCATTTCATTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233250] SGN-U586078 Tomato 200607 Build 2 48 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50236 [Download] [View] Facility Assigned ID: TOVAV53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0083 Quality Trim Threshold: 12.5