EST details — SGN-C23863

Search information 
Request: 23863Match: SGN-C23863
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23863Clone name: cLED-6-I5
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175020 is on microarray TOM1: SGN-S1-1-7.1.14.20
See unigene SGN-U575308 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C175020 [TUS-20-E2] Trace: SGN-T189897 EST: SGN-E377686 Direction: 3' Facility: INRA
Clone: SGN-C175020 [TUS-20-E2] Trace: SGN-T189898 EST: SGN-E377687 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233229Length: 522 bp (783 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233229 [] (trimmed) CCGAAACCAGCTCCATCTCCTCCATCGCCAGTCAAGCCACCTACTACTTGTGATGATATGTACAGTTGCCCATCAGGAACAACGTGTTGCTGTGT
CTACGAGTACTATCACATGTGCTTTGCTTGGGGTTGCTGCCCTATGGAAGGAGCTACTTGCTGTAAAGACCATAACAGTTGCTGCCCACATGATT
ATCCTGTCTGCAATGTTAAAGCCGGCACCTGCTCAATCAGCGAGAATAACCCTCTTTCAGTCAAAGCAATGTCACACATTCTTGCCAAACCTATT
GGATCCTTCAGCAATCAGGGAATGAAAAACACTATCTCTTGAAGTGTCTCCAATGGGAATGCGCAAATTCGCAGTGAATTTGCAAAACCTCATTT
CCAGCTGAAAGTTTATAGTTATAGGTGATTCCAAAAGCAGAGGATAACAGAGTTGCTGCTGATTTCTGTATAGTGCTTCTTTAGTGCTTGTCACA
CAATGCACTAGAACAATATTGAAACAAGATTTCATTGTTCTGCTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233229] SGN-U575308 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50215 [Download] [View] Facility Assigned ID: TOVAU51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0036 Quality Trim Threshold: 12.5