EST details — SGN-C23914

Search information 
Request: 23914Match: SGN-C23914
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23914Clone name: cLED-6-L1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175066 is on microarray TOM1: SGN-S1-1-1.2.13.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175066 [TUS-20-F24] Trace: SGN-T190195 EST: SGN-E377973 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233186Length: 533 bp (1318 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E233186 [] (trimmed) CTCCATTAGAGACCAAATTCGAACTTTAGTGAATACCCAAATGGCGATTTCATCGTCTTCACTCTCAGCAGCTCTTTTTCCAATGTGTAATTCAT
CTTCCATTTCTGCACAACCCAAGTTTTCTCTTCTGTCTTTGCATTCAAATTCTGTTAAGTTACAAGTTTTCAACCAATCTCGAGTGTCTACAACT
AAGGTTTTTGCTTCTCCTGAAGTTTTGGATGCCCAGAATGTTGAAGCTGATGTTGAGGATATTCTAGCTGCTTCAACGCTGAGTATTGGTGGTGA
CTCTGACAAGGCAGCTCCAAAGCAGAAGATTAGGATCAAATTGAGGTCATACTGGGTACCCCTAATAGAAGACTCTTGTAAGCAAATTATGGATG
CTGCAAGAACGACAAATGCAAAGACCGTAGGTCCTGTACCACTGCCCACCAAAAAGAGAATTTACTGAGTTCTCAAATCTTCACATGTTCACAAA
GATGCCAGGTTCCATTTCGAAATAAGAACTCATCAACGTCTTATTGACATTCTTTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233186] SGN-U583011 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50172 [Download] [View] Facility Assigned ID: TOVAW61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0187 Quality Trim Threshold: 14.5