EST details — SGN-C23932

Search information 
Request: 23932Match: SGN-C23932
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C23932Clone name: cLED-6-L4
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184161 is on microarray TOM1: SGN-S1-1-2.1.16.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184161 [TUS-44-A23] Trace: SGN-T191866 EST: SGN-E390540 Direction: 3' Facility: INRA
Clone: SGN-C184161 [TUS-44-A23] Trace: SGN-T191867 EST: SGN-E390541 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E233111Length: 537 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E233111 [] (trimmed) TTGAATTACACGAAAGATCTTACAATCTTGTTGTCTATTTTACATGTTCGTTAAAACTTTTAAGATATAAAGATCTGGTTTTGTCACTTCTATGA
GTTATGTAAACACAACTTTCATCAGATTTAAACGTATTTTCCTCTTTTATTAGAAATATTAGAACGACTTAAGATTTTGATACGTGCAATAACAA
TCCAGTAGAGACACACTCGAGGAAGATGCTATCTATAGATATCATATGCTTTTTGCAGTATCGTGATCTGAATTCCTAACACTGTTGTGCTTTCA
ACCTTACTACTATGTGTGTTATTCACCCTGAAACTGTCTAATTATCCTCCAAAAATGTTTATAATTATTCCTTGGAACTTATATTCATCTGTTTT
ATATTCTAGAAAGTTTATGAGTAGTATAAACGATATCTATTTACCTTCATCCCTTCATAAACAGAATTTGCAACGGAGCATCAAGAAATGTCTGC
AGATGTCATAAAAAAAGCTTTCTTGAAAACGGATGAGGAGTTCTTGTCACTTGTGAAGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E233111] SGN-U575502 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50097 [Download] [View] Facility Assigned ID: TOVAX62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5