EST details — SGN-C24089

Search information 
Request: 24089Match: SGN-C24089
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24089Clone name: cLED-7-C7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175197 is on microarray TOM1: SGN-S1-1-6.4.13.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175197 [TUS-20-L11] Trace: SGN-T1352 EST: SGN-E378161 Direction: 5' Facility: Giov. Lab
Clone: SGN-C175197 [TUS-20-L11] Trace: SGN-T189996 EST: SGN-E377497 Direction: 3' Facility: INRA
Clone: SGN-C175197 [TUS-20-L11] Trace: SGN-T189997 EST: SGN-E377498 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231793Length: 517 bp (762 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231793 [] (trimmed) ATTGCTATCGATACCATATTAAACCAAAAGCAACTGAACTCAAGGGCCACCTCTGAGAGTGAGACATTGTATTGTGTCTATGTAGCGATTGGACA
GAAACGCTCAACTGTGGCACAATTAGTTCAAATTCTTTCAGAAGCGAATGCTTTGGAATATACTATTCTTGTAGCAGCCACCGCTTCGGATCCTG
CTACTCTACAATTTTTGGCCCCATATTCTGGGTGTGCCATGGGGGAATATTTCCGCGATAATGGAATGCACGCATTAATAATCTATGATGATCTT
AGTAAACAGGCGGTAGCATATCGACAAATGTCATTATTGTTACGCCGACCACCAGGTCGTGAGGCTTTCCCAGGGGATGTTGTCTATTTACATTC
CCGTCTCTTAGAAAGAGCGGCTAAACGATCGGACCAGACAGGCGCAGGTAGCTTGACCGTCTTACCCGTGATTGAAACACAAGCTGGAGACGTAT
CGGCCTATATTCCCACCAATGTGATCTCCATTACTGATGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231793] SGN-U577869 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50302 [Download] [View] Facility Assigned ID: TOVAY16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0126 Quality Trim Threshold: 14.5