EST details — SGN-C24109

Search information 
Request: 24109Match: SGN-C24109
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24109Clone name: cLED-7-D7
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175209 is on microarray TOM1: SGN-S1-1-2.4.13.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175209 [TUS-20-L23] Trace: SGN-T190080 EST: SGN-E377581 Direction: 3' Facility: INRA
Clone: SGN-C175209 [TUS-20-L23] Trace: SGN-T190081 EST: SGN-E377582 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232053Length: 474 bp (781 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232053 [] (trimmed) GGGACATTCTACAAAGCAGTACTTGATGATGGCACTTCACTTATGGTTAAGAGGTTGCAGAATACTCAACACTCAGAGAAAGAGTTTACATCCGA
GATGGCTACGTTGGGAAATGTGAAGCACCGTAACCTGGTACCTCTTTTAGGTTTCTGCATGGCGAAAAAAGAAAGGCTGTTGGTCTACAAAGATA
TGCCAAATGGCACCTTGCATGATAGGTTGCATTCATTGAGTGAAGGGGAAAAAACTCTTGAGTGGCCTATGAGAATGAAAATCGCCATTGGAGCA
GCCAAAGGATTTGCATGGCTTCACCACAACTGCAATCCTCGTATCATTCACAGAAATATTAGTTCTAAATGCATCTTGCTGGATGTGGAATATGA
ACCTAAAATATCAGATTTTGGACTTGCTAGGCTCATGAATCCAGTTGACACTCATTTGAGTACCTTCGTAAATGGGGAATTCGGGGACTTTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232053] SGN-U580725 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50562 [Download] [View] Facility Assigned ID: TOVBA16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5