EST details — SGN-C24113

Search information 
Request: 24113Match: SGN-C24113
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24113Clone name: cLED-7-E10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175211 is on microarray TOM1: SGN-S1-1-8.1.13.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231843Length: 604 bp (787 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E231843 [] (trimmed) TCGCTAGAGAATCGAAAAAAATCGAATACAGTCCATTTTTCACTCGGCGACGATGAAGGCTTCATTCAAAGCACGATATGAGCCCGACAAAGCCG
CCGCCAACGCTACTGTTGCATTCAACGCCGGCGACCTTAAGCTCCGAGCCTCCATGACCGATGCTACTGTTGTCAAAGGTCCCAGCTTAAACGGA
TTATCTCTGGCCGTTGAGAAACCTGGATTGTTCATCGTCGACTACAACGTCCCGAAGAAGGACATTAGGTTTCAATTTATGAACTCAATCAAGGT
TCTGGAGAAGCCATTGAATTTGAATTACATTCATTTTCATGGAGACAAGCGAACAATATTGGATGGAACTTTGGTGGTTGATTCTGCCAACAAGG
TGTCGGCTAATCATGTCATGGGCTCAGGAAGTTGTAAATTAAAGTACACATATGTCCACGGAGGAATCACTACTTTCGAGCCCATCTATGATACA
GCAAAGAATGCGTGGGACTTCATGGTATCACGTAAAGTTTATGGGGATGACGTGTTTAAGGCTACTTATCAGACAACAAGCAAAAATTTGGGGCT
CGAATGGTCCAGGAGTTCTAAGTTAAATGGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231843] SGN-U575290 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50352 [Download] [View] Facility Assigned ID: TOVAZ29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5