EST details — SGN-C24142

Search information 
Request: 24142Match: SGN-C24142
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24142Clone name: cLED-7-F18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175227 is on microarray TOM1: SGN-S1-1-8.1.13.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232108Length: 577 bp (800 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232108 [] (trimmed) CAGGTTGTCCGTAACATCGCCAATATGGTCCCACCTTACGATCAGACAAAATATTCTGGAGTGGGTGCAGCAGTCGAATATGCAGTTGTCCACTT
GAAGGTGGAGAATATTTTGGTGATTGGGCACAGCTGTTGTGGAGGTATTAAAGGACTTATGTCTATTCCTGATGATGGGTCCACTAAAAGTGATT
TCATTGAGGAATGGGTGAAAATCTGCTCAACAGCCAAGGCAAAGGTAAAGGCAGAATTCTGTGATTTGGATCACAGTGAACAATGCACCAAATTG
GAGAAGGAAGCTGTGAATGTATCACTAGGGAACTTATTGACATATCCATTTGTGAGAGAAGCTGTGGTGAAGAAAAACATTGCACTAAAAGGTGG
ACACTATGATTTTGAGAATGGATCCTTTGAGCTTTGGAATATTGACTTCAAACTTACTCCTTCTGTTGCACTCTAAATATGTTGCAAAATTTTCA
TATAACCAATTGTAATTGTGTTTCAAGATTTTCTTCTTCTTTACTTGATTTGCATTTTGATGTAAATGTATTACTGAACAACAGTGTGGTGTGTC
ATCACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232108] SGN-U577363 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50617 [Download] [View] Facility Assigned ID: TOVBB33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0053 Quality Trim Threshold: 12.5