EST details — SGN-C24193

Search information 
Request: 24193Match: SGN-C24193
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24193Clone name: cLED-7-H23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185880 is on microarray TOM1: SGN-S1-1-3.1.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185880 [TUS-48-I14] Trace: SGN-T188346 EST: SGN-E376306 Direction: 3' Facility: INRA
Clone: SGN-C185880 [TUS-48-I14] Trace: SGN-T188347 EST: SGN-E376307 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232070Length: 499 bp (776 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232070 [] (trimmed) TGAAGATCACAGCTTTGATGGTGTTGAAATGCAATCCAGAAGGTTCGGATCCTGTGATCTTAGCAAACGCTTCTGATGTTAACCATTTTGGGTAT
TTTCAGAGATCCAGCGTTAAGGAATTTATCGTTTTTGTGGGTCGAACTGTTGCTAAAAGGAACCCACCTGGACAACGACAATCTGTTCAGCATGA
AGAATACAAGGTGCATTCATACAATCGAAATGGTTTATGTGCTTTGGGCTTCATGGATGATCACTATCCAGTTCGAAGTGCATTTTCACTGCTCA
ACCAGGTTTTGGATGAGTATCTGAAGAATTTTGGTGAGTCATGGAAGACGGCTCAATGCGACAATGCTCAACCATGGCCTTATCTGAATGAAGCT
CTAGCCAAATTTCAGGATCCTGCTGAGGCCGATAAGCTGTTCAAAATTCAACGAGAGTTGGATGAAACATAAATTATTCTCCATAAGACAATTGA
CAGTGTCTTAGAACGTGGTGAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232070] SGN-U574515 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50579 [Download] [View] Facility Assigned ID: TOVBA48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5