Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C24208

Search information 
Request: 24208Match: SGN-C24208
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24208Clone name: cLED-7-I17
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175268 is on microarray TOM1: SGN-S1-1-7.3.13.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175268 [TUS-20-O10] Trace: SGN-T189872 EST: SGN-E377661 Direction: 3' Facility: INRA
Clone: SGN-C175268 [TUS-20-O10] Trace: SGN-T189873 EST: SGN-E377662 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231971Length: 537 bp (793 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231971 [] (trimmed) CAGGTTGCATCAAGTTCTTGGAAACAGTTGGTCTGCTATTGCAGCAAGATTACCCGGAAGAACAGATAACGAAATAAAAAACATTTGGCATACTC
GTCTGAAGAAAAAAAGGAATGAATCTCAACTTAAAGAAACCCAATCGGAGCCTGAAAATACTAATGTAGATGTACATTTGGAGGAGGCCAACAAT
TCTAATGATAAACATTCCGAAATATCGAATCTTAAAATAAACATCGAAATCCAACAACAACCAAGTCCATCATCGTCAGTATCATCATCAAGTGA
AGATTCATGTTCAAATACGACTGCAACGAGTTCAGAGTCGAGAAATCAAATAATGTCCGATAATTTGTTAGAAATTGATGACGATATTTGGTCCG
AGGTAGTATGGGCACAAGTCGATGACAATTATGTTGATTTGTCATTAATGGAGGATAATTACCACATTAATTCTAGCTCTGATGATAATTGGTTT
TGGGATGATCTTTTTACAAGATCTAATGAGTTGATGTTAGAATTGCCTGAATTATGAGCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231971] SGN-U564591 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50480 [Download] [View] Facility Assigned ID: TOVAY57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0140 Quality Trim Threshold: 14.5