Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C24343

Search information 
Request: 24343Match: SGN-C24343
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24343Clone name: cLED-7-O2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182302 is on microarray TOM1: SGN-S1-1-5.4.8.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232036Length: 554 bp (802 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232036 [] (trimmed) CAGGATTGCTCTGCTCAAAGCCACACAAAGTGAGGCTATTAGAAACTATTACCATGACCATCATGTCATTCAAGATCTCCTTGTTCCTCTTTACA
AGGTCGGTGATTGTCTCGAGTGGGTTCATCGCGAGATGGAGGTATATCCAATTTGGCTGTGCCCACACAGAATTTACAAGCTGCCAGTGAGACCA
ATGATCTACCCTGAACCAGGATTCGAGAAACACAAAAGGCAGGGTGACACCGAATATGCACAAATGTATACTGATGTTGGTGTGTACTATGTTCC
GGGAGCAGTCCTGAGGGGTGAGCCGTTTGATGGTTCAGAGAAATGCCGACAACTTGAGCTTTGGTTGATAGAGAACCATGGATTTCAGGCTCAAT
ACGCGGTGACTGAGCTGACAGAGAAGAATTTCTGGAGGATGTTTGATAACGGTCTGTACGAGCAATGCAGAAGGAAGTACAAAGCTATCGGAACG
TTCATGAGTGTGTACTATAAATCGAAGAAAGGAAGGAAGACAGAGAAGGAAGTGCAGGAAGCTGAGCAAGAGAAAGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232036] SGN-U578468 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50545 [Download] [View] Facility Assigned ID: TOVAZ85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5