Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C24365

Search information 
Request: 24365Match: SGN-C24365
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24365Clone name: cLED-7-P21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175359 is on microarray TOM1: SGN-S1-1-4.3.13.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C175359 [TUS-21-C5] Trace: SGN-T190251 EST: SGN-E377060 Direction: 3' Facility: INRA
Clone: SGN-C175359 [TUS-21-C5] Trace: SGN-T190252 EST: SGN-E377061 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232095Length: 590 bp (773 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E232095 [] (trimmed) TGAAAAAGGAGCCTTGGTTTGCATAGATGGAACATTTGCAACTCCTCTTAACCAGAAGGCCCTTGCTCTAGGGGCTGACCTTGTTGTGCACTCTG
CTACAAAATTCCTTGGTGGGCACAACGATGTTCTTGCAGGTTGTATTAGTGGTCCTGAAAAATTAGTTTCAGTAATCCGAAACTTGCATCATATC
CTGGGTGGTGCTCTCAATCCTAATGCTGCATATCTTATCATCCGAGGCATGAAGACGCTGCATCTTCGTGTACAGCAACAAAATTCTACTGCATT
GAGGATGGCCGAAATTTTAGAGGCTCATCCCAAGGTGAAACACGTCTATTATCCAGGCTTGCCGAGTCATCCGGAATATCACCTTGCAAAGAAAC
AAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAGGTTGATGGAGACCTACTAACTACTGCAAAATTTGTGGATGCTCTGAGGATTCCTTATATT
GCTCCATCGTTTGGAGGTTGTGAGAGCATTGTGGACCAACCAGCAATAATGTCTTATTGGGATCTTAGCCAGTCTGATAGAGCAAAGTATGGCAT
CTCGGATAACTTGGTCCGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232095] SGN-U578164 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50604 [Download] [View] Facility Assigned ID: TOVBA95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5