EST details — SGN-C24469

Search information 
Request: 24469Match: SGN-C24469
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C24469Clone name: cLED-8-G2
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184253 is on microarray TOM1: SGN-S1-1-6.1.16.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184253 [TUS-44-E19] Trace: SGN-T192116 EST: SGN-E390790 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232756Length: 459 bp (1163 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232756 [] (trimmed) GCCTGCTAGTATACCCATATATGCAGAATTTAAGTGTTGCTTATCGTCTACGTGAACTTAAACCTGGGGAGCCTGTTTTGAATTGGCCAACTAGG
AAGCGTGTGGCGGTGGGTACTGCACGTGGACTTGAATACCTACATGAACACTGTAATCCAAAGATTATTCACCGTGATGTTAAAGCAGCTAATGT
GTTACTAGATGAAGATTTTGAAGCTGTAGTTGGTGATTTTGGCCTGGCAAAGCTAGTTGACGTTAAGAAAACCAATGTGACTACTCAAGTTCGTG
GTACAATGGGCCATATAGCTACTGAATACTTATCCACTGGCAAATCATCAGAAAAAACTGATGTTTTTGGCTATGGAATCATGCTTTTGGAAATT
GTAACCGGCCAACGTGCAATAGACTTCTCACGCCTAGAAGATGAAGATGATGTCTTGTTGCTTGACCATGTCAGAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232756] SGN-U584981 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50689 [Download] [View] Facility Assigned ID: TOVBD37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5