Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C2510

Search information 
Request: 2510Match: SGN-C2510
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C2510Clone name: cLEC-16-E19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173415 is on microarray TOM1: SGN-S1-1-4.2.18.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173415 [TUS-16-B5] Trace: SGN-T196661 EST: SGN-E395335 Direction: 5' Facility: INRA
Clone: SGN-C173415 [TUS-16-B5] Trace: SGN-T196774 EST: SGN-E395448 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204934Length: 330 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204934 [] (trimmed) CTTACAAGGCACACACAGTGTATGCCCACAAGGAAACATGCAGTGAGGAAGTAAAAGTAGAAAAAATGGTCACCAGAAATCTGCAAAAGCTTGTA
TCGCCATCATCTGGTGGAATAGGCAATGATCCAGGATCTGGAAATACTACTAAGCTGGAATTAGTCTGGGGTAGTACAATGTATCATATAGATGA
CCTTCCATTTGACTGTGAGAGTTTACCAGATGTGTACACTCAGTTCCGTAAGTCAGTGGAATACAAATCAAAAGTTCGTAATTGCACTAAACTCC
CAACATCATTTGGTCCTCCACCAGAGGTTGGGGATTGGGGACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204934] SGN-U563587 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26823 [Download] [View] Facility Assigned ID: TCACI34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5