EST details — SGN-C26548

Search information 
Request: 26548Match: SGN-C26548
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26548Clone name: cLEF-40-M16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176351 is on microarray TOM1: SGN-S1-1-4.4.10.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176351 [TUS-23-L13] Trace: SGN-T181380 EST: SGN-E368453 Direction: 3' Facility: INRA
Clone: SGN-C176351 [TUS-23-L13] Trace: SGN-T181381 EST: SGN-E368454 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246282Length: 616 bp (927 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246282 [] (trimmed) GAGTTTTAAATTCTTTGAACAAAGAAAAAAAGAGCTAATCACTTTTTGTATTAAAGTTTGCTGGAGATTTGTATTTAATTTGTCGACAAGACAGG
AAAAATTCTGGGGTGTTAAGTTTTTCTTGATCGTTTTTTGGTGGTATTGAAGTTATGGAAGACAAAAGCAATGATTATTATGCAGTTTTGGGGTT
GAAGAAGGAATGCACTGACACAGAACTTAGGAATGCCTATAAGAAGCTTGCACTGAAATGGCACCCAGATCGCTGTTCAGCATCGGGGAATTTGA
AGTTTGTAGATGAAGCAGAAGAAGCAATTTCAGGCAATTCAAGAAGCATATTCTGTGTTATCGGATGCAAACAAAAAGTTTTTGTACGATGTAGG
AGTTTATGACTCTGGTGATGATGACGACGAAAATGGCATGGGTGATTTCCTGAATGAAATGGCAGCTATGATGAGCCAAAATAAGTCCAATGAAA
ATCAGGGAGAAGAAACCTTTGAGGAATTGCAGGATATGTTTAATGAAATGTTCAACAGTGATAATGGAACGTTNTCTTCTTCTTCTTCTTCTTCT
TCTTCTTCTTGGACTGGAACTCCTTCAATGTGCTCTACTACATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246282] SGN-U572726 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60134 [Download] [View] Facility Assigned ID: TMGGB80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5