EST details — SGN-C26622

Search information 
Request: 26622Match: SGN-C26622
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26622Clone name: cLEF-41-B15
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176379 is on microarray TOM1: SGN-S1-1-8.1.10.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176379 [TUS-23-M17] Trace: SGN-T181011 EST: SGN-E369437 Direction: 3' Facility: INRA
Clone: SGN-C176379 [TUS-23-M17] Trace: SGN-T181012 EST: SGN-E369438 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246876Length: 403 bp (956 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246876 [] (trimmed) GAAAAGGTTCCCTGTGTGGAGGATTTTGAATTGAAGGCTATGAATCCTTATGGTCGAACAAAGCTATTTCTTGAAGATATTGCACGGGATATCCA
GAAGGCTGATCAAGAATGGAATATCATACTGTTGAGGTATTTCAACCCGGTAGGAGCTCATGAAAGTGGCAAACTCGGGGAAGAATCCAAAGGGC
ATTCCGAACAATCTTATGCCTTACATTCAGCAAGTAGCTGTTGGTAGATTGCCGGAGTTGAATGTATATGGCAACGACTACCCTACACCTGATGG
TACCGCGATACGAGATTATATCCATGTTATGGATTTGGCGGACGGTCATGTTGTTGCACTTCAGAGACTTCTAAGGCAGAATCACATAAGTTGTG
TTGCCTACAATTTGGGTACTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246876] SGN-U564745 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60291 [Download] [View] Facility Assigned ID: TMGGG08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5