Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C26777

Search information 
Request: 26777Match: SGN-C26777
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26777Clone name: cLEF-41-I23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176450 is on microarray TOM1: SGN-S1-1-1.4.10.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176450 [TUS-23-P16] Trace: SGN-T1406 EST: SGN-E378375 Direction: 5' Facility: Giov. Lab
Clone: SGN-C176450 [TUS-23-P16] Trace: SGN-T181548 EST: SGN-E368621 Direction: 3' Facility: INRA
Clone: SGN-C176450 [TUS-23-P16] Trace: SGN-T181549 EST: SGN-E368622 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246818Length: 493 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246818 [] (trimmed) ACAAGCTCTGGGACGACACCGTTGCCGGTCCCCGGCCAGATAGTGGCCTCGGGAAGCTCCGGAAGTATTCTACTTTTAGTCAGCGTTCAAATTCC
GGCAAGGAATCAGAAGTTTCAACACCGAGATCCTTTACTGAGGAAGCAAGTGAGGACGCGGTGAAGGTGACGAGAAGTATCATGATCGTAAAGCC
TTCCGGGAGTCAGAATAGAGATTCACCTCCCGTTTCTCCGGCCGGTACTACTCCTCCGGTATCTCCTTTTTCTGGTTCTTCTGGAAGAGAAGCAT
TTCGGTTCCGTCGGCGATCAGCGTCATTTGCATACGAGAATGCCAGTGGGGTTGGACCCAGAAGCCCTCGTCCTCCTTACGACCTGTGAGATATA
GTCGGGTTCTCCTTTTTTGTTTTCCTTCTTGAGGCGGCTGAATGTAGTATAGCTTAGTCGACATTACTCAACATGTTCCTCGTTGAGAATGTTGT
TTTGTGTGGACTTGTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246818] SGN-U582094 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60233 [Download] [View] Facility Assigned ID: TMGGE60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0105 Quality Trim Threshold: 12.5