EST details — SGN-C26936

Search information 
Request: 26936Match: SGN-C26936
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26936Clone name: cLEF-42-A22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176526 is on microarray TOM1: SGN-S1-1-5.3.9.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176526 [TUS-24-C20] Trace: SGN-T193064 EST: SGN-E391738 Direction: 3' Facility: INRA
Clone: SGN-C176526 [TUS-24-C20] Trace: SGN-T193065 EST: SGN-E391739 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247523Length: 525 bp (1012 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247523 [] (trimmed) CTCGTTTCCCCAAACAGAGTCTTCGAAGCCGCCGGCCATAATCTCCGGTTGCTTTGCTAAATCTACGGTGACCACTTTCCGATCTCCTCTCAGTT
CCCGTTGAATAGAAAATGGCTGACGGTGAGGATATTCAGCCCCTTGTTTGTGACAATGGAACTGGAATGGTGAAGGCTGGATTTGCTGGTGATGA
TGCCCCTAGAGCAGTGTTTCCTAGCATTGTTGGTCGTCCTCGCCACACTGGTGTTATGGTTGGAATGGGTCAGAAAGATGCATATGTTGGTGATG
AAGCTCAATCCAAGAGGGGTATCTTGACCTTGAAATACCCAATTGAACACGGTATTGTCAGCAACTGGGATGATATGGAGAAGATCTGGCATCAT
ACTTTCTACAATGAGCTTCGTGTTGCCCCCGAGGAGCACCCTGTTCTGCTTACTGAAGCACCTCTCAACCCTAAGGCCAACAGAGAGAAAATGAC
CCAGATTATGTTTGAGACCTTCAACGTTCCAGCTATGTATGTTGCTATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247523] SGN-U580609 Tomato 200607 Build 2 89 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60567 [Download] [View] Facility Assigned ID: TMGGJ11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5