Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-C26943

Search information 
Request: 26943Match: SGN-C26943
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C26943Clone name: cLEF-42-A9
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176529 is on microarray TOM1: SGN-S1-1-2.3.9.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176529 [TUS-24-C23] Trace: SGN-T1407 EST: SGN-E378678 Direction: 5' Facility: Giov. Lab
Clone: SGN-C176529 [TUS-24-C23] Trace: SGN-T192944 EST: SGN-E391618 Direction: 5' Facility: INRA
Clone: SGN-C176529 [TUS-24-C23] Trace: SGN-T193178 EST: SGN-E391852 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247650Length: 616 bp (933 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247650 [] (trimmed) CGACGCTGCCGGTTCTCCGTTTACAGAAATCTCCATTGTTTCCAAGTGATTGTTGATTCGAACAGAGCTATGGTAGGAACAAGTGCAGTAATCGA
ATCGATGGGTTCAGCTGTTAATGGAAAGGAGGTGGCGGATGTTCGATTTGATCCGACGGCTGTAGTACCGGAGCTGGTGCCTGCAGTGGTGAAAT
CGGAAGTAGATGCGGCGGTTAATGGCGGTGGCCAGGAGCAGAAGAGGGAGATAGTGTTAGGGAGGAATATACATACGTCGTCCTTTTCTGTTACG
GAACCTGATGCGGATGATGATTCTACTGGTGATAAGGAAGCGTATATGGCTAGTGTTCTAGCTCGGTATAGGAAGACTCTCACTGATCGAACTAA
GTATCATTTAGGGTATCCATATAATTTGGATTTCGATTATGGTGCACTCACACAATTGCAGCATTTCTCCATCAATAACTTAGGAGATCCATTCA
TTGAGAGCAACTACGGTGTGCACTCAAGGCAGTTTGAAGTTGGTGTTTTGGACTGGTTTGCACGCCTATGGGATATTGAAAAGGATGAATATTGG
GGATACATCACAAACTGTGGAACTGAAGGAAATCTTCATGGAATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247650] SGN-U584469 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60694 [Download] [View] Facility Assigned ID: TMGGI05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5