Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-C27131

Search information 
Request: 27131Match: SGN-C27131
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27131Clone name: cLEF-42-K13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176623 is on microarray TOM1: SGN-S1-1-4.3.9.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176623 [TUS-24-G21] Trace: SGN-T193193 EST: SGN-E391867 Direction: 3' Facility: INRA
Clone: SGN-C176623 [TUS-24-G21] Trace: SGN-T197825 EST: SGN-E396499 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247506Length: 529 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247506 [] (trimmed) CAAGTACAAACCAAAATAACTTATGCAAAAGAAAACTCCCAAATACAGAGTGATTGTTTTTCCTTCTTTCTTTTACAAAGGTATTTTTGTCAATC
GAAATAATACGAAGAACAAGATAAAAGGGGAGTCATAGTAATAATGCTAAAAACGATAACTAGACAAGTTTGACGTCCTATCAACCTTCCCAGAT
CATCGACCTCCATATGTCCAGCACTAATAGTACAAGTTCGATTCACTGGCACATCGAGATAGTCTCACAAGAAAGAGGTCAGAGATAAAGTTAAG
CAGAATTTACAGGTGTGTTTGCATGTTTAGATATACTTTCGATCCTTCATAATAGTACATTCAAACTCAAAAAGTTGTTGCTACCACATCCCAGC
GCCATATAGTCCCATCTTCACAACAGCTAAGTATGGTGCTTCCATCAAAAGACATGGCAGTCTGTCTAATTGGTTGTTTAGATTGAACATGAGAC
AGCTTTGCAATCAAAGTTGGCGGGCTTTGTTGTACTTCCCAGACAAAGATCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247506] SGN-U585084 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60550 [Download] [View] Facility Assigned ID: TMGGI67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5