EST details — SGN-C27184

Search information 
Request: 27184Match: SGN-C27184
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27184Clone name: cLEF-42-M4
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176647 is on microarray TOM1: SGN-S1-1-4.4.9.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176647 [TUS-24-H21] Trace: SGN-T193383 EST: SGN-E392057 Direction: 3' Facility: INRA
Clone: SGN-C176647 [TUS-24-H21] Trace: SGN-T197854 EST: SGN-E396528 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247550Length: 495 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247550 [] (trimmed) AAAGAGAATGAAGACGGATATTATAGATATCGCCACACATGTTTAAAGTACAGAACATTTACAAGCATATATATGTTTGATGAAATTTTCTACTT
TACAGTAATCTTATTCCACAACATATGTATAAGAATAGTAATTATAATATGTTAATCTTATGATAATTTGATGCAACACATATATATAAAGATGA
TCTTATATTTGATTTGAAACCCTGTAGTAATTTGTCAAAGTCTTCCCATCCAACTCCTTTGAAAAGAACCTCCCCATGTAATCCGTGTACATGAA
TTCGCGGTAAACTGCTGGCTTTTCATCTGATATCAGTTCAGGCAGAGGTCCAAATGAGTTCTCTCTTTGTCCTGGATTAAAGAAGATGGCAACTG
ATACGCGGGGTTCTTGGAAAGGGTTGGCTAGAACTCGGTGCACCACGCTCTTGTATTCATCATTCGATATTATCTGAAGAATATCACCAATATTA
ATCACAATAGCCCCCGGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247550] SGN-U570114 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60594 [Download] [View] Facility Assigned ID: TMGGJ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5