Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-C27192

Search information 
Request: 27192Match: SGN-C27192
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27192Clone name: cLEF-42-N11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180543 is on microarray TOM1: SGN-S1-1-4.3.19.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180543 [TUS-34-K5] Trace: SGN-T193503 EST: SGN-E392177 Direction: 5' Facility: INRA
Clone: SGN-C180543 [TUS-34-K5] Trace: SGN-T193727 EST: SGN-E392401 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247757Length: 594 bp (962 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247757 [] (trimmed) GTCAAAAGTATGTTGCACTTGGCTGAACTGGTTGAGAAACATAATGATCAAATTGCAACGTTCGAGACTTGGGACACTGAGAAGCCATATGAACA
GGCTGTTAAGATTGGAGTACGCTGGTTGTACATCCCCGTTATTATGCTGGTAAGTAATAAGTTCAACTAGAAAGAAAGTCTATCATCAATTATTT
CTTCTCCCTGAAAAAAAATTATTTCTACAGGCTAGGTAGATAAAATTCTTGATATGACTATTCCTGCTGAAGGACCATATTGTATTCAAACGTTG
CATGAACTGATTGAATTTGTTGGTTAGATTATCTCATGAAATTTTGCTCTCCTCGTGTTCTCTTGGAAGATGAGCCCTACTTTCACTTGTGGCAG
AAATATCGTGTTAAAAATGCTGAGCAGACCCCTTTAACTACACTCTATGTAGAAAATCTGTTGCAGGAGGTAGCATCAAAATTTTCTCTTTTATT
GCCCAAAAGAGTCGTTTTGCACAGTAAGTCAAGTTTCAGTTTTTCTGGTATCGTATCTGAGTGAAAGAATATGTTTTTTTCTTTTCAATTTTAGA
AAAAATATTTCACAACAGTTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247757] SGN-U572175 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60801 [Download] [View] Facility Assigned ID: TMGGK78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5