Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C27415

Search information 
Request: 27415Match: SGN-C27415
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27415Clone name: cLEF-43-L23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183095 is on microarray TOM1: SGN-S1-1-4.1.3.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183095 [TUS-41-E13] Trace: SGN-T191481 EST: SGN-E390155 Direction: 3' Facility: INRA
Clone: SGN-C183095 [TUS-41-E13] Trace: SGN-T197473 EST: SGN-E396147 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245621Length: 605 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E245621 [] (trimmed) GGCAAGGAAATGTGGTGCCGAGGAATTGTGGTTCTCACTGATGCTCAGCTTTCCCCTCCTGATGGATTGACTTATGAAGAATTCACGTCCCGAAG
ATCAGAGGCACTTTTGAAAATCGTCCGGATGGGTGCTCGAATCAGGAAACAAGACATTCAGGCTGCTTCAATTCCTGTTGTCTTGGTTGAGAATA
GTGGCAGATGTAACAAGAATGAAAGTGACGAAAAGATTCTTCCAAGTGGAATTGCGTGGATACCCAATTTAGTCCAAACTATTACAGATGCTGTT
TTAAGTGGAAGCAAGGGTATTTTGGTTGATCAAAAACTGATTGAAGGTCCTAATCCAAACAATAGGGGCAAAGTGCTAATTCCTTTTATACTAGC
ATTCCAGTATTTCTTTGTAGTGAAAAGGATCCAGAGGTCCATTAAGAATGATATTGCACGGGAGACCAGGCCTTCATGGGCATAAACATTCATTG
GAATGGCTCTTGTTTGTCAACTTAATTCCCCTTTTGGTTCTTTGAAGGATTTTGGATTTCCTTGCCATCAGCTTATCAGTTTATACTTTTCTTGG
TTAAGTAATTATATTTATTAGTAGCCAGAGAAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245621] SGN-U581266 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61040 [Download] [View] Facility Assigned ID: TMGGO72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0093 Quality Trim Threshold: 12.5