EST details — SGN-C27873
| Search information |
| Request: 27873 | Match: SGN-C27873 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C27873 | Clone name: cLEF-45-N16 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: Alias clone SGN-C176783 is on microarray TOM1: SGN-S1-1-4.2.9.17
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C176783 [TUS-24-N13] | Trace: SGN-T193158 | EST: SGN-E391832 | Direction: 3' | Facility: INRA |
| Clone: SGN-C176783 [TUS-24-N13] | Trace: SGN-T193159 | EST: SGN-E391833 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E246780 | Length: 185 bp (893 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E246780 [] (trimmed)
CTTCAGGGCGATCTTTTTCTCTGTGAGATCACCTTCTATCTTCTCCGGTGTATGGCGGCGGCCCATCTTCTCGGGCGTAAAACTCGACTCCCGCC
GGGAACCCTTGGCCTCCCGTTTATCGGAGAAACCCTCCAGTTAATTTCTGCGTACAAAACGGAAAATCCTGAACCGTTCATCTAAGACTC
GGGAACCCTTGGCCTCCCGTTTATCGGAGAAACCCTCCAGTTAATTTCTGCGTACAAAACGGAAAATCCTGAACCGTTCATCTAAGACTC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E246780] | SGN-U564608 | Tomato 200607 | Build 2 | 26 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T61515 [Download] [View] | Facility Assigned ID: TMGGX80TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.973 | Expected Error Rate: 0.0410 | Quality Trim Threshold: 14.5 |
Working
