Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C27881

Search information 
Request: 27881Match: SGN-C27881
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27881Clone name: cLEF-45-N24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176789 is on microarray TOM1: SGN-S1-1-6.2.9.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176789 [TUS-24-N19] Trace: SGN-T193160 EST: SGN-E391834 Direction: 5' Facility: INRA
Clone: SGN-C176789 [TUS-24-N19] Trace: SGN-T199154 EST: SGN-E397828 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246628Length: 570 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246628 [] (trimmed) ATCGTTTCCGATACCTCGCGTCATCCATGGGTCTTTGGGAAGCTGTGCTCAATTGGCTCCGAAGCCTCTTCTTTAAACAGGAAATGGAGCTTTCT
TTGATAGGGCTGCAAAATGCAGGGAAAACTTCACTTGTAAATGTTATTGCTACTGGTGGATATAGTGAAGATATGATACCAACGGTGGGATTTAA
CATGAGGAAAGTGACTAAAGGTAATGTCACTATAAAATTGTGGGACCTTGGAGGTCAACCCAGATTCCGAAGTATGTGGGAAAGATATTGTCGTG
CAGTTTCAGCTATAGTTTATGTTGTTGATGCTGCTGATCATGATAATCTTAGCATTTCTAAAAGTGAACTCCATGACCTGCTGAACAAGACATCA
TTGAGCGGTATTCCGTTGCTGGTATTGGGGAACAAGATTGACAAACCTGGAGCTCTGTCCAAGCAGGCTTTGACTGATGAGATGGGATTGAATTC
TATAACAGACAGAGAGGTGTGCTGCTATATGATATCATGCAAAAATTCCACCAATATTGACTCTGTTATTGATTGGCTTGTCAAGCACTCCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246628] SGN-U571252 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61363 [Download] [View] Facility Assigned ID: TMGGX84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5