EST details — SGN-C27935

Search information 
Request: 27935Match: SGN-C27935
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27935Clone name: cLEF-46-B11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176810 is on microarray TOM1: SGN-S1-1-1.3.9.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176810 [TUS-24-O16] Trace: SGN-T193358 EST: SGN-E392032 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247223Length: 486 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247223 [] (trimmed) ACAGAATAACATTATTTTAATTGAGTTGCAAGGAAGGTACATTATTTAAGTGATTCTGGGGCAATCATAAGCACCTTACAGGATGAATTCAAGAG
CGAAACAGGTGTATCTGCACCAATTTCACTAGCCAAAATTGATTCCTTGAGCCAATGGTAGTTCACTCCCATAGTTGATTGTACAAGTTGAGCGT
CTCATATATTGTTTCCAAGAATCACTTCCTGCCTCACGGCCACCACCAGTACCTTTCTCACCTCCAAAAGCACCGCCAATTTCAGCTCCATTTGT
TGGGATATTCACATTGACGATGCCACAATCACTTCCTTGAGGTCCAATCCACTTAAATATATTTTCTGGGTTTCGGGTGAAGATGGAACTACTTA
AACCTTGAGGGACAGAGTTGTTGATTTCAACTGCTTCTTCAAAAGTCTTAAACTTCATTACATAAAGAACTGGAGCAAACAATTCTTCCTTCACA
ATTTCAGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247223] SGN-U572837 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61634 [Download] [View] Facility Assigned ID: TMGHA06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0093 Quality Trim Threshold: 14.5