Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C27985

Search information 
Request: 27985Match: SGN-C27985
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C27985Clone name: cLEF-46-D20
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180651 is on microarray TOM1: SGN-S1-1-8.3.19.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180651 [TUS-34-O17] Trace: SGN-T193525 EST: SGN-E392199 Direction: 5' Facility: INRA
Clone: SGN-C180651 [TUS-34-O17] Trace: SGN-T193741 EST: SGN-E392415 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247412Length: 595 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247412 [] (trimmed) CTCTATCAGTGTAGCTCTTAAACCCTAGGAATTTTTTTACATCTCTCCACGCCGATTCTATCTTTCTCTCCTCTCCACTCCACATCAATGGAAGA
TGTATGTGAAGGCAAAGATTTCTCTTTCCCAAATCAAGAAGAAAAAATCCTTCAATGGTGGGAAGAAGTCAAAGCATTCGAAAACCAGCTCGAAA
AGACAAAAAATCAACCCGAATACATTTTCTACGATGGTCCTCCATTTGCAACAGGTTTACCTCATTACGGCCACATATTAGCAGGTACAATCAAA
GATATTGTGACCAGGTATCAATCAATGACGGGTCATCATGTGACCCGAAGATTTGGGTGGGATTGTCATGGATTACCAGTTGAACATGAAATTGA
TGAGAAACTTCAGATTAAGACTAAACAACAAGTGATTGAAATGGGGATTGATAAGTATAATGAGGAATGTAGAGCTATTGTGACAAGGTATGTTG
GAGAATGGGAAAAAACTGTGGTGAGAATGGGGAGATGGATTGATTTTCAGAATGGGTATAAGACTATGGATTTGAAGTATATGGAGAGTCTTTGG
TGGGTTTTTGCTAAGCTGCATGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247412] SGN-U567896 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61823 [Download] [View] Facility Assigned ID: TMGHB22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5