Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-C28078

Search information 
Request: 28078Match: SGN-C28078
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28078Clone name: cLEF-46-H9
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180300 is on microarray TOM1: SGN-S1-1-7.1.19.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180300 [TUS-34-A2] Trace: SGN-T1620 EST: SGN-E378195 Direction: 5' Facility: Giov. Lab
Clone: SGN-C180300 [TUS-34-A2] Trace: SGN-T193527 EST: SGN-E392201 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247315Length: 469 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247315 [] (trimmed) GCAGATTTTCAGTCTGTACTTAGCACTTTCACTCGTTATAGTCGGTTAAGAGTCATTGCTGAACTTCGGCATGGGGATCTGTTTCACTCGGCCAA
TATTGTTTCAAGCATTGAATTTGATCGGGATGATGAGTTGTTTGCTACTGCTGGAGTTTCACGGCGTATAAAAGTTTTTGACTTCTCTTCAGTTG
TAAATGAACCTGCAGATGCACACTGCCCTGTTGTTGAAATGTCTACCCGATCTAAGCTGAGCTGCTTGAGTTGGAATAAGTATACCAAGAACCAC
ATAGCTAGTAGTGATTATGATGGAATAGTAACTGTATGGGATGTGACGACTAGACAGAGTGTGATGGAATATGAAGAGCATGAGAAACGGGCTTG
GAGTGTTGATTTTTCACGCACAGAACCCTCGATGCTTGTATCTGGCAGTGATGATTGTAAGGTCAAAGTTTGGTGCACGAAGCAAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247315] SGN-U579490 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61726 [Download] [View] Facility Assigned ID: TMGHA41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5