EST details — SGN-C28448

Search information 
Request: 28448Match: SGN-C28448
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28448Clone name: cLEF-47-L11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C183048 is on microarray TOM1: SGN-S1-1-3.3.3.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183048 [TUS-41-C14] Trace: SGN-T191746 EST: SGN-E390420 Direction: 3' Facility: INRA
Clone: SGN-C183048 [TUS-41-C14] Trace: SGN-T191747 EST: SGN-E390421 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247912Length: 627 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247912 [] (trimmed) CAAGTGTGAGGCATTTGAGTAATAATGTGCAGAAACAGGGCTGGTGCTCTGAACTTGTACGTCGTTTTTCTACAGAGTCTGAGAAACAACAAGTA
GATGGCAGTGGAAAATCGGAGAAACAAGAAGTAGCTGTTTCCGACAGTGGCAAACAATCGAAGCTATTTCAAAGAAGACGCCGCCGTGGTAATCT
TTGGAGACGCAATGAATACGACTTTGCACCTGCTCTTGTCGAAAACTTACCAACGGGACTTGGCAATGCATTATTGCAAGCCACACAGAACATCA
ACAAGATATTTGATAATTTCAACTTGAATCCCTCACAATTACTGGGAAGGTACAAAGAGGATGATAAGAATTACAAAATCCGTTACGACGTGCCA
GGACTCGGCAAGAAGGACGTGAAGATCATGGTTGAGGATGGAATTTTGACAATAAAAGGTGAACACAAACAAGAGAAGGAAGAAGAAGGATCAGA
TGATGAGTTTTGGTCATCAACAAGTTATGGTTACTATAATAATAGCATTGTGTTGCCTCAAGATGCTAAGGTTGATGAAATTAAAGCTGAGATGA
AAGATGGTGTTTTGACAATTACTATTCCTAAAAGTGACAAACCTAAGAAAGATGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247912] SGN-U563517 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61941 [Download] [View] Facility Assigned ID: TMGHE66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5