Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C28634

Search information 
Request: 28634Match: SGN-C28634
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28634Clone name: cLEF-48-I11
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180352 is on microarray TOM1: SGN-S1-1-3.3.19.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180352 [TUS-34-C6] Trace: SGN-T199212 EST: SGN-E397886 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245682Length: 554 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E245682 [] (trimmed) CAAATCTATTGTCATGATGGGAGATAAGCTCTTCAGTTCCCACCAAGATCATAAAATCCGAGTATGGAAAATTGACAATGAGACACCTAATAGAA
ATTACAAGAGCATTGCCACCTTACCAACGATCAACGATCGTTGCGTGAAGCTATTTTGGACAAGGAACTACGTACAAGTTCGAAGACACAAGAAA
TGCACATGGGTACATCACGTAGACACGGTGTCAGCATTAGCCTTATCGAAAGATGGCTCTCTGCTTTACTCTGCTTCATGGGACAGAACATTTAA
GATTTGGAGAAGTTCAGATTTCAAATGCCTAGAATCAGTATGGAATGCACATGACGACGCGATCAACTCAATAGTTGTATCGAATAATGGAGATG
TTTACACTGGTTCAGCAGACAAGAAGATCAAAATATGGACTAAACAACAAGAAGGGGGTTCTAATAAACACACTCTTATGACTGCACTAGAGAAG
CATAAATCAGCAGTGAATGCTTTGGCTCTTAGTAGAGATGGTTGTGTTTTATACTCTGGTGCTTGTGATAGGTCTATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245682] SGN-U581742 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62171 [Download] [View] Facility Assigned ID: TMGHG54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5