EST details — SGN-C28782

Search information 
Request: 28782Match: SGN-C28782
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C28782Clone name: cLEF-49-D18
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176976 is on microarray TOM1: SGN-S1-1-3.2.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176976 [TUS-25-F14] Trace: SGN-T182123 EST: SGN-E369634 Direction: 3' Facility: INRA
Clone: SGN-C176976 [TUS-25-F14] Trace: SGN-T182124 EST: SGN-E369635 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249115Length: 479 bp (1018 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E249115 [] (trimmed) GTATCAAGTTCACTGTCGATGGAGGTGGACTCGGTCGGAAATAAAAATGTTCATACATTTGAAAGTCTTAATTTGGTCTATGATAACATTGTATC
AGTAGGAGAATATACAATGCCTAGTATCATGGATAAGTTGGCTGTGTCCTCAAACTTTTTTCAACGTAGCAAGATGATAGAACAGTTCAACCAGA
AAAGCACATGGAAGAAAAGGGGTATCTCCCGAGTACCAATCGTGTATTAAGCTATAGAACAATCGAAACCAGGAAAAGTCAGTATTCTGCAAGAC
GGATCAATTGTTGTAGAGGTAGGAGGGATTGAGATTGGCCAAGGGTTATGGACAAAGGTTAAGCAGATGACTGCCTATTCTCTTGGTTTAATCGA
AAGCAGTTGGGCCGAAGAACTTGTGGAGAAAATACGAGTCATACAAGCAGATACCTTAAGCATAGTGCAAGGTGGGTATACAGCTGGGAGCACTA
CATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249115] SGN-U582237 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62623 [Download] [View] Facility Assigned ID: TMGHN21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5